haplogroup g origin
It is provided at the request of readers. Capelli C, Brisighelli F, Scarnicci F et al. It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. Evaluation of Y-chromosomal STRs: a multicenter study. Peter A Underhill. Am J Hum Genet 2000; 67: 15261543. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Distribution. Kivisild T, Rootsi S, Metspalu M et al. The L141 mutation is found on the Y chromosome at 2948607. Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the ISSN 1018-4813 (print), Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus, Subdividing Y-chromosome haplogroup R1a1 reveals Norse Viking dispersal lineages in Britain, Phylogenetic analysis of the Y-chromosome haplogroup C2b-F1067, a dominant paternal lineage in Eastern Eurasia, Y-chromosomal connection between Hungarians and geographically distant populations of the Ural Mountain region and West Siberia, Origin and diffusion of human Y chromosome haplogroup J1-M267, Bidirectional dispersals during the peopling of the North American Arctic, The role of matrilineality in shaping patterns of Y chromosome and mtDNA sequence variation in southwestern Angola, Ancient human mitochondrial genomes from Bronze Age Bulgaria: new insights into the genetic history of Thracians, Medieval Super-Grandfather founder of Western Kazakh Clans from Haplogroup C2a1a2-M48, Early medieval genetic data from Ural region evaluated in the light of archaeological evidence of ancient Hungarians, http://harpending.humanevo.utah.edu/popstr/, Population genetic study of 17 Y-STR Loci of the Sorani Kurds in the Province of Sulaymaniyah, Iraq, Phylogenetic history of patrilineages rare in northern and eastern Europe from large-scale re-sequencing of human Y-chromosomes, Sex-biased patterns shaped the genetic history of Roma, Middle eastern genetic legacy in the paternal and maternal gene pools of Chuetas, Cancel The first principal component separates the populations of the Caucasus from those of Europe, with the Near/Middle Eastern populations being intermediate (Figure 3a). Neolithic mitochondrial haplogroup H genomes and the genetic - Nature This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. Nei M : Molecular Evolutionary Genetics. Am J Hum Genet 2004; 74: 5061. Although progress has been recently made in resolving the haplogroup G phylogeny, a comprehensive survey of the geographic distribution patterns of the significant sub-clades of this haplogroup has not been conducted yet. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Kharkov VN, Stepanov VA, Borinskaya SA et al. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. 8 Oldest Haplogroups and the Regions they Originated From Using Y-STR data, the Td expansion time for all combined P15-affiliated chromosomes was estimated to be 150822217 years ago. Haplogroup - an overview | ScienceDirect Topics contracts here. Y-STR haplotypes were used to construct phylogenetic networks for haplogroups G-P303, G-P16 and G-M377, using the program Network 4.6.0.0 (Fluxus-Engineering, Suffolk, England, UK) and applying the median-joining algorithm. Haplogroup G-P303 - Wikipedia Dulik MC, Osipova LP, Schurr TG : Y-chromosome variation in Altaian Kazakhs reveals a common paternal gene pool for Kazakhs and the influence of Mongolian expansions. The haplogroup G mutation developed about 21,000 to 14,000 years ago. Origins and history of European Y-DNA and mtDNA haplogroups Chromosome Y microsatellites: population genetic and evolutionary aspects. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. Two additional markers, DYS38829, 30 and DYS46131 were typed separately. Origin. A network analysis of representative hg G-P16 Y-STR haplotypes reveals a diffuse cluster (Supplementary Figure S2). Furthermore, markers Page94, U5, U8 and L30 were typed in contextually appropriate samples to establish the position of the five new markers within the phylogeny. Excavating Y-chromosome haplotype strata in Anatolia. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). There are seeming pockets of unusual concentrations within Europe. Eur J Hum Genet 2010; 18: 348353. Luis JR, Rowold DJ, Regueiro M et al. The presence of M527 in Provence, southern Italy and Ukraine may reflect subsequent Greek maritime Iron Age colonization events16 and perhaps, given its appearance among the Druze and Palestinians, even episodes associated with the enigmatic marauding Sea Peoples.42. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. This is likely due to a local founder effect.[40]. Haplogroup P (P295) is also klnown as K2b2. The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in the western Caucasus Mountains. Internet Explorer). L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. Behar DM, Yunusbayev B, Metspalu M et al. The Caucasus are today mainly the countries of Georgia, Armenia, Azerbaijan and southwestern Russia. The fragments were run on the ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). Geographic spread patterns of the P303-derived groups defined by L497, U1 and P15(xP303)-derived P16 and M406 lineages, all of which achieve a peak frequency of at least 10%, are presented in Figures 2bf, respectively. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. Achilli A, Olivieri A, Pala M et al. G-L13/S13 (Y-DNA) - geni family tree Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. ), Haplogroup M, as of 2017, is also known as K2b1b. Int J Legal Med 1997; 110: 134149. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. Ann Hum Genet 2004; 68: 588599. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. Kayser M, Caglia A, Corach D et al. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. [7], (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming. Mol Biol Evol 2006; 23: 22682270. We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. Am J Hum Genet 2004; 74: 10231034. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Balanovsky O, Rootsi S, Pshenichnov A et al. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. Correspondence to The discovery of new SNPs can result in assignment of new names to haplogroup categories. There are multiple SNPs which so far have the same coverage as P15. Eur J Hum Genet 2009; 17: 820830. [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. Yunusbayev B, Metspalu M, Jrve M et al. Eur J Hum Genet 2003; 11: 535542. The naming of sub-clades is according to YCC nomenclature principles. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ : Iran: tricontinental nexus for Y-chromosome driven migration. Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. G1-M285, previously described in the Iranian population . King RJ, DiCristofaro J, Kouvatsi A et al. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. We attempted to localize the potential geographic origin of . Am J Hum Genet 2004; 74: 694704. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. A separate study on the Argyns found that 71% of males belong to G1. The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. Eur J Hum Genet 2004; 12: 855863. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). Semino O, Passarino G, Oefner PJ et al. Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. Mol Biol Evol 2011; 29: 359365. G2a2b2a is also found in India. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. Semino et al. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. Dulik MC, Zhadanov SI, Osipova LP et al. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. . The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. Encyclopedia of mtDNA Origins - Discover your maternal lineage. Slider with three articles shown per slide. Here we present the haplogroup frequency distribution and STR variation of 16 informative G sub-clades by evaluating 1472 haplogroup G chromosomes belonging to 98 populations ranging from Europe to Pakistan. PAU thanks Professor Carlos D Bustamante. PubMedGoogle Scholar. [38][self-published source?] Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J : High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula. However, no clinal patterns were detected in the spatial autocorrelation analysis of the five sub-haplogroup frequencies with distance, suggesting that the distributions are not clinal but rather indicative of isolation by distance and demographic complexities. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. G2a2b1 is more common in southern Europe than northern Europe. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. Hum Hered 2006; 61: 132143. Nonetheless, our approach using high-resolution phylogenetic relationships as well as their phylogeography to infer the possible origin of a genetic variant provides a more plausible deduction than simply the region of highest frequency. [citation needed] The suggested relevant pre-historical climatic and archeological periods specified in conjunction with lineage-specific estimated expansion times are specified in the summary portion of Supplementary Table S4. Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists. The most detailed SNP mutation identified was S126 (L30), which defines G2a3.[11]. It is a branch of haplogroup G (Y-DNA) (M201). Haplogroup G was the first branch of Haplogroup F outside of Africa. Haplogroup G (Y-DNA) - Origins - LiquiSearch The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. Croat Med J 2005; 46: 502513. The P303 SNP defines the most frequent and widespread G sub-haplogroup. Google Scholar. This value of 12 is uncommon in other G categories other than G1. First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. The L141 mutation involves an insertion.[35]. The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. Balanovsky O, Dibirova K, Dybo A et al. Y-chromosome lineages from Portugal, Madeira and Acores record elements of Sephardim and Berber ancestry. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. Haplogroup LT (L298/P326) is also known as Haplogroup K1. Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north.
Are Fireworks Legal In Sugar Land, Tx,
Steve Allen Rowe,
Brenda Spencer Father, Wallace,
Persian Funeral Music,
Articles H